From: Jesse F. W (jessefw_at_loop.com)
Date: Mon Feb 18 2002 - 11:04:28 PST
------- Forwarded message follows -------
Date sent: Wed, 05 Sep 2001 08:39:50 -0400
To: frc_at_trolltech.com (fantasy rules committee)
From: "Jeremy D. Selengut" <selengut_at_nih.gov>
Subject: Round 167 final summary
Congrats on a good round everyone! On to you, Jesse...
(A microsoft word document version of this summary is attached)
<**Removed by me**>
Round 167
Theme: Biotechnology
Eligibility:
Jesse Welton Sep 04, 02:38:07 +4.5 Current Style Leader
Aron Wall INELIGIBLE +2.0
Kitt Bartlett INELIGIBLE +0.8
David Lerner INELIGIBLE +0.6
Karl LowINELIGIBLE +2.25
Jesse F. W. INELIGIBLE -2.5
Factitious INELIGIBLE +1.5
David Glasser INELIGIBLE +0.5
Mark Nau INELIGIBLE +0.5
> All others < INELIGIBLE
Rule summary:
167:1 Kitt Bartlett Aug 20, 14:18:55 VALID +0.5 Words begin
w/ACTG
167:2 Karl LowAug 20, 16:13:00 INVALID +1.0 Inconsistent w/167:1
167:3
David Lerner Aug 20, 16:39:36 VALID +0.5 No restriction 167:4
Jesse F.
W. Aug 20, 16:55:17 INVALID +1.0 Inconsistent w/self 167:5 David
Glasser Aug 21, 03:07:23 INVALID +0.5 Inconsistent w/self 167:6
David
Lerner Aug 21, 15:26:50 VALID +0.1Establishes patents 167:7
Jesse F.
W. Aug 21, 17:30:39 VALID +0.5No restriction 167:8 Karl Low Aug
21,
18:20:23 VALID +0.75 Reuse of 1/2 patents 167:9 Kitt Bartlett Aug
21,
18:47:30 INVALID -1.0 Inconsistent w/167:1 167:10 Jesse F. W.
Aug 21,
18:50:11 INVALID -2.0 Inconsistent w/self 167:11 Kitt Bartlett Aug
21,
18:55:02 INVALID +0.5 Inconsistent w/167:8 167:12 Jesse Welton
Aug 21,
21:38:17 VALID +2.5 Genetic Code, No odd patents 167:13 Kitt
Bartlett
Aug 22, 16:12:42 INVALID +0.5 Inconsistent w/167:3... 167:14 Kitt
Bartlett Aug 22, 18:27:12 VALID +0.1 Incl. of a word from its
patent 167:15 Mark Nau Aug 22, 19:34:59 INVALID +0.5 Inconsistent
w/167:1... 167:16 Kitt BartlettAug 22, 22:30:20 INVALID +0.2
Inconsistent w/self 167:17 Aron WallAug 23, 04:43:20 VALID +2.0
Parentage & splicing 167:18 Jesse F. W. Aug 23, 16:27:40 INVALID -2.0
Inconsistent w/167:17 or 14 167:19 FactitiousAug 25, 05:32:00 INVALID
+1.5 Inconsistent with 167:8 167:20 Karl Low Aug 27, 19:41:06
INVALID +0.5 Inconsistent w/167:1... 167:21 Jesse Welton Aug 28,
02:38:07 VALID +2.0 G-content > 1/4
Patented Phrases:
David Lernerphrase of at least six words
Jesse F. W. all future rules must obey this
Karl Low If I can see further than others, it is because I have stood
on the
shoulders of Giants
Jesse Welton1) The genetic code of a rule
2) Be informed, stay healthy
Kitt BartlettThe patented code of this rule
Aron Wall Our overworked Judge must be informed
Genetic Codes:
[Note: I make no assurances that these codes are correct. Valid rules
are in BOLDFACE] 167:1 AATCA GATAC TTATC AG 167:2 CATTT TAATA ATCAG
CTCAC ATTAT 167:3 TTTCA GTTAA TC 167:4 TTATT CGTTA ATTAA ATTTT 167:5
CAATT TTTGT C 167:6 TGTAT ATTAT CTTAT TACAA AATTA T 167:7 ATCGA 167:8
TTTAC TTGTG TACTA TTTAA TATTT AATTT TA 167:9 ATAAT CCACT ATCC
167:10TTATT CGTTA ATTAA ATT 167:11ACAGT TGATT ATCTA TCAG 167:12TGCAT
ATTTA GCATA AGACA GCTC 167:13GCGAG TTAAA 167:14TCTAA CATTG 167:15AAATA
TTATT TGCAT GGAAC TA 167:16TCTAT GA 167:17CTAAA ATGCT TCCAC TAGAC AT
167:18TCTAA CTTTG T 167:19CACTG CACTG 167:20 TTAAT TTTA 167:21
ACGTC TTAGG GTA
***************
The Valid Rules
***************
167:1 - Kitt Bartlett
As adenine, thymine, Cytosine and Guanine are the sole building blocks
of DNA, all rules must contain words that begin with the letters 'a',
't', 'c', and 'g'.
167:3 - David Lerner
The First One In
|It's useful to remember that| many Companies, universities, And
Governments have rushed into Biotechnology, before They've even
explored the potential risks and dangers. In accordance, we do not
need Rule 167:1 to start creating rules.
167:6 - David Lerner
It is possible to patent Genetically modified life-forms. So, each
time A rule uses The "phrase of at least six words" from the previous
rule, that phrase is now patented, and the poster who created the rule
is the only one allowed to use it in subsequent rules. If Rule 167:5.
is declared invalid, then a poster Can place any one "phrase of at
least six words" in quotes, and it is patented and the poster is the
only one allowed to use it.
167:7 - Jesse F. W.
"all future rules must obey this" rule.I can't get away from rule #1.
167:8 - Karl Low
The purpose of patents is to encourage future rules to build upon what
is already known. "If I can see further than others, it is because I
have stood on the shoulders of Giants" I believe it was said.
Therefore, while grabbing the whole of a patent is certainly wrong, it
should be encouraged to use part of a patent. To this end, it is
required that all future rules splice in exactly half of any patented
phrase that appeared in the rule previous. Since trying to splice in
half a word is just nonsensical, valid patents will have an even
number of words. To show my dedication to this idea. I'll do it in
this rule as well.
167:12 - Jesse Welton
"The genetic code of a rule" is the sequence of building blocks of DNA
found at the beginnings of the words of the rule. Every rule has a
unique genetic code which distinguishes it from all others. Unlike in
the US, invalid patents are not allowed. Further, giants are
prohibited: No future rule can have a genetic code longer than 25
characters.
167:14 - Kitt Bartlett
"The patented code of this rule" is a virus. All future rules must
contain at least one word from this rule's patent. Preserve the
genome.
167:17 - Aron Wall
Future rules' codes must be made in two ways only:
Old Fashioned Way:
Your rule must have a VALID rule and an INVALID rule as parents. Put
the rules' genetic codes in either order, then remove every other
letter to be left with your starting code for your rule.
Cloning:
Pick one rule either VALID or INVALID for a parent, reproducing its
exact code.
Then put in any genetic material from words spliced in accordance with
previous rules. You now have your code for your rule. "Our overworked
Judge must be informed" which rules are the parent(s) or it is
invalidated for not having proper documentation.
167:21 - Jesse Welton
Parents: 1, 13.
Advisory: Chronic Guanine deficiency found in 90% of rules. Studies
show low levels of this key building block of our rules' DNA can lead
to patent obsession disorder, degenerative restriction disease, even
terminal invalidity. Future rules must maintain a genetic Guanine
density greater than 1/4.
FRC Health Avisory Board
"Be informed, stay healthy"
*******************
Rules & Judgements
*******************
167:1 - VALID
Christopher Bartlett <bridgeweaver_at_mediaone.net>
> As adenine, thymine, Cytosine and Guanine are the sole building
blocks of > DNA, all rules must contain words that begin with the
letters 'a', 't', > 'c', and 'g'.
Judgement: VALID
Style: A rather uninspired restriction, I'm afraid, but not overly
problematic as befits a rule early in the round. Call me a stickler,
but in real life anyway, Adenine, etc. are not the sole building
blocks of DNA, just the nucleotide bases. DNA also includes the
deoxyribose sugars and the phosphate groups. Including a first-timer
bonus, I award +0.5. *******
167:2 - INVALID
Karl wrote:
Begin 167.2
----
Goodness, can a word begin with more than one letter?
No matter, since this is FRC, we know that the DNA of a rule is
actually the individual words in it. Now which words qualify as
adenine, thymine, Cytosine and Guanine, I have no clue. Still, it's
useful to remember that every FRC rule will contain a cluster of at
least five of the DNA, in the same order, as the previous rule. -----
Judgement:
Rule 1 says: adenine, thymine, Cytosine and Guanine are the sole
building blocks of DNA Rule 2 says: the DNA of a rule is actually the
individual words in it Is there a way to reconcile these? I wish the
words "sole" and "actually" were not there, but they are. What does it
mean for something to "actually" be something else - it could be that
the DNA is only apparently made of A T C and G, in fact, it is not,
its made of the words of a rule. Imagine this: Physicist #1: The sole
building blocks of matter are subatomic particles Physicist #2: Matter
is actually the atoms composing it Thus, one POSSIBLE interpretation
of these two rules is that the DNA of a rule is the words in it and
those words, in turn, are composed at some level of the four bases, A
T C and G. Having found one possible and, I deem, reasonable
interpretation I will not judge this rule INVALID on this count. I
will stress that having found one interpretation does not rule out a
possibly infinite suite of other reasonable interpretations, all of
which are still in play until such time as a future rule narrows
things down. Players need not hew to the one interpretation I have
outlined if they can think of another. The Judge, of course, unless
overruled by vote, is the arbiter of reasonableness, but I will remind
players also that an alternative interpretation need not be _more_
reasonable than the one I outlined, just not unreasonable. I'm
spelling this out for the benefit of the new players so that they
understand my philosophy of judging. Having said all of this, I will
nonetheless judge the rule INVALID for one of the oldest and most
tedious reasons in the FRC. This rule requires ALL rules to contain
something found in the previous rule. As there is no rule previous to
the first rule, the first rule is not in compliance with this
restriction. If the rule had specifically exempted the first rule or
said "from now on", or "in the future" or some other such thing it
would have been valid. So sorry. Style: For making my head spin with
the repercussions of the DNA for the word Adenine is the word Adenine
which is composed of, most likely, Adenine... +1.0 *******
167:3 - VALID
David wrote:
The First One In
|It's useful to remember that| many Companies, universities, And
Governments have rushed into Biotechnology, before They've even
explored the potential risks and dangers. In accordance, we do not
need Rule 167:1 to start creating rules.
Judgement: A truism. However, you'd better not ignore 167:1, because
the Judge does need to pay attention to it when judging your rules.
Which I have. No problems here. Style: On theme, but where's the beef
(GM, or otherwise), there's nothing here to restrict other rules.
Except for the fact that it is a capital R, Rule, this is not a rule,
it is a comment... Including the new player bonus, I award +0.5
*******
167:4 - INVALID
Begin rule
------------------------------
The last word of each sentence in each new rule must be the
same as the first word in the sentence, except one letter may be
mutated, by removal or change; e. g. the becomes toe. ;-)
Lock up all hope of adding letters, for that is not true mutation, if
you look. On your honor, words must be real words, and repetition is a
no-no. But hyphenation is alright, so stop the with the tut, tut.
------------------------------ End rule Jesse F. Weinstein; did I hear
something, what?
Judgement: INVALID, In the second to last sentence, the mutation ON to
NO-NO (or NO) is not allowed by this rule (note that the rule
restricts "each new rule" and this is a new rule). The only mutations
allowed are removal of one letter or change of one letter where change
is exemplified by the transformation of THE to TOE. Style: Good idea,
unfortunate execution. With the new player bonus, +1.0 *******
167:5 - INVALID
167:4
>>>
Rules from now on must contain a phrase of at least six words,
indicated with quotes, that must be used in the following Rule in
order for it to be valid; they will serve to pass on genetic
information, something that can't be done by mules.
>>>
--David Glasser
Judgement: INVALID. Does not follow its own restriction.
Style: Is a mule an INVALID rule? An interesting concept to build on,
perhaps? Otherwise, not much excitement here. With the new player
bonus, +1.0. -- *******
167:6 - VALID
Begin rule
------------------------------
It is possible to patent Genetically modified life-forms. So, each
time A rule uses The "phrase of at least six words" from the previous
rule, that phrase is now patented, and the poster who created the rule
is the only one allowed to use it in subsequent rules. If Rule 167:5.
is declared invalid, then a poster Can place any one "phrase of at
least six words" in quotes, and it is patented and the poster is the
only one allowed to use it. ------------------------------ End rule
Judgement: VALID. Only sticky point is caused by: "any one phrase..."
Here, David has placed two phrases in quotes, not one. I'll allow that
since they are the same phrase, they can count as one phrase, not two.
Style: The patenting idea is on theme, but there is nothing
genetically modified about these phrases. The chance of someone
accidentally using a patented six word phrase is remote, so this is
not much of a trap for anyone. David has sacrificed elegance and
courage for the safety of a hedged bet on the validity of 167:5. It's
true that this game is more about getting valid rules than style, but
I don't have to award positive style for wishy-washiness... +0.1
*******
167:7 - VALID
Begin rule-----------
"all future rules must obey this" rule.I can't get away from rule #1.
End rule---------------- Jesse F. Weinstein
Judgement: VALID
Style: Good use of the patent laws to grab a useful phrase, but It
will have to be a long round before this bears tactical fruit. Besides
this, there's no restriction: +0.5. *******
167:8 - VALID
Begin 167:8
-----------
The purpose of patents is to encourage future rules to build upon what
is already known. "If I can see further than others, it is because I
have stood on the shoulders of Giants" I believe it was said.
Therefore, while grabbing the whole of a patent is certainly wrong, it
should be encouraged to use part of a patent. To this end, it is
required that all future rules splice in exactly half of any patented
phrase that appeared in the rule previous. Since trying to splice in
half a word is just nonsensical, valid patents will have an even
number of words. To show my dedication to this idea. I'll do it in
this rule as well. ------------
Judgement: VALID. The phrasing of "valid patent" is problematic, if it
means that a patent with an odd number of words is not a patent and
does not receive patent protection under 167:6, then this rule is
inconsistent with 167:6. Thus, the "validity" of a patent is undefined
at this time (this is not inconsistent with the R.O.'s which only are
concerned with the validity of rules) and the handling of odd-worded
patents with regard to this rule is left as an exercise for the first
one to be confronted with the problem. Anyone who wants to attempt to
close this loophole by defining "valid patent" better is free to give
it a shot... Style: I would like to remind everyone that the round's
theme is Biotechnology, not Patent Law. +0.75 *******
167:9 - INVALID
Begin rule
A word has the following properties:
1. It is preceded by at least one space.
2. It is followed by a space or one of the following punctuation
characters: .!?,;:"
3. It can be found in a dictionary.
"Only character strings that meet all these criteria" may be
considered words. end rule Submitted by Kitt Bartlett
Judgement: INVALID. Inconsistent with 167:1, no word beginning with
the letter "G". Style: VERY unstylish to fall prey to one's own rule,
and considering how few restrictions there are so far, that was a wee
bit embarrassing, no? Property #3 has loopholes big enough to drive
a
truck through - a dictionary of Latvian slang, anyone? Even if it were
airtight, was this necessary? It has nothing to do with the theme and
is boring to boot. Consider yourself lucky with only -1.0. *******
167:10 - INVALID
------------------------------
The last word of each sentence in each new rule must be the
same as the first word in the sentence, except one letter may be
mutated, by removal or change; e. g. the becomes toe. ;-)
Lock up all hope of adding letters, for that is not true
mutation, if you look. On your honor, words must be real words,
and repetition within a rule is a no. Bit of bio-piracy: "all rules
must include these words"; that's it. ------------------------------
Jesse Weinstein
Judgement: INVALID. Read my comment from last time carefully,
Jesse...
ON -> NO is not allowed. Style: Resubmission of a rule isn't so bad,
resubmitting a rule that still fails is pretty cheesy - it stinks like
limburger. -2.0 *******
167:11 - INVALID
All future rules must contain a genetic modification of the patented
phrase from the previous rule. Valid genetic modifications are limited
to the following: 1. You may delete exactly one word. 2. You may add
exactly one word. 3. You may substitute exactly one word for exactly
one word in the sequence. "Only character strings that meet any
these
criteria" are valid genetic modifications.
Submitted by Kitt Bartlett
Judgement: Inconsistent with 167:8 which requires the "splicing in"
of
exactly 1/2 of any patented phrase that appears in the rule previous.
167:8 is the most recent rule. Style: +0.5 *******
167:12 - VALID
-- begin --
"The genetic code of a rule" is the sequence of building blocks of
DNA
found at the beginnings of the words of the rule. Every rule has a
unique genetic code which distinguishes it from all others. Unlike in
the US, invalid patents are not allowed. Further, giants are
prohibited: No future rule can have a genetic code longer than 25
characters. --- end --- Submitted by Jesse Welton
Judgement: VALID. Does this rule "splice in exactly half of any
patented phrase that appeared in the rule previous"? The problem is
the word "exactly". The phrase in question has 18 words, 10 of which
are found in this rule. Two of them, "the" and "of" are found multiple
times. I can find a consistent interpretation in regarding nine of
these to have been "spliced" in, the rest were in this rule prior to
the splicing events - we just don't know at this point which words
were spliced and which weren't. Disallowing invalid patents resolves
the problems that arose with 167:8, now rules containing invalid
patents will be found invalid. Style: Builds naturally on 167:1 in a
fascinating way that opens up all kinds of possibilities. I like it.
+2.5. (The genetic code of this Judgement is:
TATATTTTATTTTAATCAACTTTTTTATTATTCATATGCTT) *******
167:13 - INVALID
geneticists cannot randomly modify genes and expect good results.
Therefore only "the patented portion of a rule" may be altered in a
subsequent rule.
Submitted by Kitt Bartlett
Judgement: INVALID. 167:3, for instance, is considerably altered from
167:1, which has no patented portion.
Style: nice idea, but fatally vague. +0.5.
*******
167:14 - VALID
"The patented code of this rule" is a virus. All future rules must
contain at least one word from this rule's patent. Preserve the
genome.
Submitted by Kitt Bartlett
Judgement: VALID.
Style: Well, it's VALID, that counts for something, doesn't it? +0.1
*******
167:15 - INVALID
A building-block sequence is heteroserial if any blocks immediately
adjacent to it must be of a type different than any of those in the
heteroserial sequence. Examination of the genetic code of every prior
rule and subsequent "expensive laboratory experimentation by top men"
has revealed GC, GCA, AG, and CGA to all be heteroserial.
Submitted by Mark Nau
Judgement: INVALID. If I read this correctly, if "AG" is heteroserial
this means that, whenever the sequence "AG" appears in a DNA sequence
(as a sub-string), the building blocks immediately preceding and
following it cannot be either "A" or "G". Unfortunately, rule 167:1
contains the text "and Guanidine are" which means that the genetic
code for that rule contains the substring "AGA". Thus, AG cannot be
heteroserial for all valid rules in this round. I cannot find any
interpretation of this rule consistent with this fact.
Style: Esoteric, but could have been interesting. Odd not to have
analyzed the genetic codes more thoroughly... +0.5. *******
167:16 - INVALID
begin
Viral transmission from 167:14 can only occur inside "patented
material for this or any future rule". Other use of these words goes
against nature.
end
Submitted by Kitt Bartlett
Judgement: INVALID. The word "of" is part of 167:14's patented
phrase, and yet is used here outside of "patented material".
Style: Might have been an effective patch for 167:14's shortcomings,
even so, the restriction is ho-hum. +0.2 *******
167:17 - VALID
>>>>>>
Future rules' codes must be made in two ways only:
Old Fashioned Way:
Your rule must have a VALID rule and an INVALID rule as parents. Put
the rules' genetic codes in either order, then remove every other
letter to be left with your starting code for your rule.
Cloning:
Pick one rule either VALID or INVALID for a parent, reproducing its
exact code.
Then put in any genetic material from words spliced in accordance with
previous rules. You now have your code for your rule. "Our overworked
Judge must be informed" which rules are the parent(s) or it is
invalidated for not having proper documentation.
>>>>>>>
Aron Wall
Jusgement: VALID. Note that "informing the Judge" must be done
_within_ future rules. The Judge cannot make decisions on the
validity
of a rule based on content (or lack thereof) not contained within the
rule itself. The extent to which a rule is in compliance with all
restrictions must be transparent (determinable, even if craftily
hidden within a rule) to all players. Thus, private messages to the
Judge cannot be required for the validity of a rule. To put this in
the context of the R.O.'s: The Judge must determine whether a _rule_
is consistent with all previous valid rules and declare it INVALID if
it is not (R.O. #6). Whether or not a _player_ has sent notification
to the Judge before or after the fact in a separate message publicly
or privately, the _rule_ did not include the required information and
so would be judged INVALID.
Style: This restriction seems a bit tough for the first week of the
round, and not applying it to this rule as an example of how it can be
done was a bit wimpy. On the other hand, the concept here is
exemplary
- Aron has at a stroke brought the round closer to the theme, given
purpose to the genetic codes and created a great splicing
mechanism
that corrects the unintended weaknesses in 167:8. +2.0 *******
167:18
Parent 167:14
"Our overworked Judge will" make us obey rules. This can't be
taken for nothing. It is a parasitic rule: A rule-writer must
carefully pick the words in their rule, ignoring patented parts, since
he must put in the genetic infomation of my rule, in the same order,
in his
Submitted by Jesse F. W.
Judgement: INVALID. This rule is attempting to clone 167:14. In
cloning the genetic code of the clone is the same as that as the
parent with the exception of any genetic material from words _spliced
in accordance with previous rules_. The only rule supporting splicing
is 167:8, which requires the splicing in of 1/2 of the patented phrase
from the previous rule. The patented phrase from the previous rule
in
this case has no genetic material. Therefore, either the genetic code
of this rule is identical to that of 167:14 (which is inconsistent
with 167:12) or it is not identical (which is inconsistent with
167:14). QED.
Style: The phrasing and grammar of this rule are awkward and its
meaning is unclear. The effect of this rule if it were valid would be
difficult in the extreme and probably round-killing. I would not
suggest resubmitting a corrected version. -2.0 *******
167:19
>>>>>>
Parents: 167:14, 167:18.
Cloning, as it is now, causes outrage for some people. So that
"spreading
genetic research won't incite zealous conservative protests", at no
point may cloned rules outnumber those produced by other methods
of
genetic reproduction.
>>>>>>
Submitted by Factitious
Judgement: INVALID. Inconsistent with 167:8, does not include 1/2
of
the patented phrase found in the previous [VALID] rule, 167:17.
Style: Topical, restriction appropriate to the ideas expressed,
utilized the genetic recombination rule properly. I would encourage
a
resubmit, but Factitious is now out of time, so sorry... +1.5 *******
167:20
This rule has the parents 167:45 and 167:16. Also, the tiny letters
have been taken out of the sequence. I have made it easy for our
overworked judge by putting my DNA in order as listed here. Finally,
I'm sick of patents. No more shall be in valid rules.
Submitted by Karl Low
Judgement: INVALID. Inconsistent with 167:1, this rule has no word
beginning with the letter "G". Beware of quick fix reposts, there are
other errors in this rule...
Style: *sigh* You'd think 167:1 would be a no brainer, but this is the
second rule that has been tripped up by its simple restriction.
Putting an end to patents on the one hand is dismantling some of the
structure of the round, which seems like poor sportsmanship, but on
the other hand, no one bothered to require them and I was getting
sick
of them too. Otherwise, not much going on here, +0.5 *******
167:21
>>>
Parents: 1, 13.
Advisory: Chronic Guanine deficiency found in 90% of rules.
Studies
show low levels of this key building block of our rules' DNA can lead
to patent obsession disorder, degenerative restriction disease, even
terminal invalidity. Future rules must maintain a genetic Guanine
density greater than 1/4.
FRC Health Avisory Board
"Be informed, stay healthy"
>>>
Submitted by Jesse Welton
Judgement: VALID
Style: On theme, with a wonderfully appropriate and consistent
voice.
The way the restriction is seamlessly incorporated into the rule's
other text should be an example to new players. +2.0 *******
------- End of forwarded message -------
This archive was generated by hypermail 2.1.5 : Thu Nov 24 2011 - 10:48 PST