Repost of summary #3 in plain text

From: Jeremy D. Selengut (selengut_at_nih.gov)
Date: Mon Aug 27 2001 - 13:01:46 PDT


Round 167

Theme: Biotechnology

Eligibility:
Aron Wall               Aug 30, 04:43:20 +2.0
Jesse Welton    Aug 28, 21:38:17 +2.5 Current Style Leader
Kitt Bartlett   Aug 28, 18:27:12 +0.8
Karl Low                Aug 28, 18:20:23 +1.75
David Lerner    Aug 28, 15:26:50 +0.6
 > All others <  Aug 27, 14:18:55
Jesse F. W.     INELIGIBLE       -2.5
Factitious      INELIGIBLE       +1.5
David Glasser   INELIGIBLE       +0.5
Mark Nau                INELIGIBLE       +0.5

Rule summary:
167:1 Kitt Bartlett  Aug 20, 14:18:55 VALID   +0.5  Words begin w/ACTG
167:2 Karl Low      Aug 20, 16:13:00 INVALID +1.0  Inconsistent w/167:1
167:3 David Lerner   Aug 20, 16:39:36 VALID   +0.5  No restriction
167:4 Jesse F. W.    Aug 20, 16:55:17 INVALID +1.0  Inconsistent w/self
167:5 David Glasser Aug 21, 03:07:23 INVALID +0.5  Inconsistent w/self
167:6 David Lerner   Aug 21, 15:26:50 VALID   +0.1  Establishes patents
167:7 Jesse F. W.    Aug 21, 17:30:39 VALID   +0.5  No restriction
167:8 Karl Low      Aug 21, 18:20:23 VALID   +0.75 Reuse of 1/2 patents
167:9 Kitt Bartlett  Aug 21, 18:47:30 INVALID -1.0  Inconsistent w/167:1
167:10 Jesse F. W.   Aug 21, 18:50:11 INVALID -2.0  Inconsistent w/self
167:11 Kitt Bartlett Aug 21, 18:55:02 INVALID +0.5  Inconsistent w/167:8
167:12 Jesse Welton  Aug 21, 21:38:17 VALID   +2.5  Genetic Code, No odd
patents
167:13 Kitt Bartlett Aug 22, 16:12:42 INVALID +0.5  Inconsistent w/167:3...
167:14 Kitt Bartlett Aug 22, 18:27:12 VALID   +0.1  Incl. of a word from
its patent
167:15 Mark Nau             Aug 22, 19:34:59 INVALID +0.5  Inconsistent
w/167:1...
167:16 Kitt Bartlett Aug 22, 22:30:20 INVALID +0.2  Inconsistent w/self
167:17 Aron Wall            Aug 23, 04:43:20  VALID  +2.0  Parentage & splicing
167:18 Jesse F. W.   Aug 23, 16:27:40 INVALID -2.0  Inconsistent w/167:17 or 14
167:19 Factitious    Aug 25, 05:32:00 INVALID +1.5  Inconsistent with 167:8

Patented Phrases:
David Lerner    phrase of at least six words
Jesse F. W.     all future rules must obey this
Karl Low                If I can see further than others, it is because I
have stood on the
                          shoulders of Giants
Jesse Welton    The genetic code of a rule
Kitt Bartlett   The patented code of this rule
Aron Wall               Our overworked Judge must be informed

Genetic Codes:
         [Note: at present it has not been clarified whether "at the
beginnings of the
words" means that the code for the word CAR is "C" or "CA".  Thus, in the codes
listed below, anything besides the very first letter is written in lower case;
I make no assurances that these codes are correct.  Valid rules are in
BOLDFACE]
167:1  AATCA GATAC TTATC AG
167:2  CaATT TTAAc tTAAT CAGCT CACAt TTAT
167:3  TTTCA GTTAA ccTC
167:4  TTATT CGTTA ATTAA ATTTT
167:5  CAAtT TTTTG TCa
167:6  TGTAT AtTTA TCTTA TTACa AAtAA TTAT
167:7  ATCaG A
167:8  TTTAC aTTGT GTACT ATTTA ATATT TAATT TTA
167:9  ATAtA TCCaA CTATC C
167:10 TTATT CGTTA ATTAA ATT
167:11 ACAGT TGATT ATCTA TCAG
167:12 TGCAT AtTTT AGCAT AAGAC aAGCT C
167:13 GCaGA GTTAA A
167:14 TCTAA CAtTT G
167:15 AAATA TTATT TGCAT GcGca AgACg aTA
167:16 TCaTA TGAga
167:17 CTAAA ATGCT TCCAC TAGAc cCAT
167:18 TCaTa AACaT TTGT
167:19 CACaT GCAtC TG


***************
The Valid Rules
***************

167:1 - Kitt Bartlett
As adenine, thymine, Cytosine and Guanine are the sole building blocks of
DNA, all rules must contain words that begin with the letters 'a', 't',
'c', and 'g'.

167:3 - David Lerner
The First One In
|It's useful to remember that| many Companies, universities, And
Governments have rushed into Biotechnology, before They've even explored
the potential risks and dangers. In accordance, we do not need Rule 167:1
to start creating rules.

167:6 - David Lerner
It is possible to patent Genetically modified life-forms. So, each time A
rule uses The "phrase of at least six words" from the previous rule, that
phrase is now patented, and the poster who created the rule is the only one
allowed to use it in subsequent rules.
If Rule 167:5. is declared invalid, then a poster Can place any one "phrase
of at least six words" in quotes, and it is patented and the poster is the
only one allowed to use it.

167:7 - Jesse F. W.
"all future rules must obey this" rule.I can't get away from rule #1.

167:8 - Karl Low
The purpose of patents is to encourage future rules to build upon what is
already known. "If I can see further than others, it is because I have
stood on the shoulders of Giants" I believe it was said. Therefore, while
grabbing the whole of a patent is certainly wrong, it should be encouraged
to use part of a patent. To this end, it is required that all future rules
splice in exactly half of any patented phrase that appeared in the rule
previous.
Since trying to splice in half a word is just nonsensical, valid patents
will have an even number of words.
To show my dedication to this idea. I'll do it in this rule as well.

167:12 - Jesse Welton
"The genetic code of a rule" is the sequence of building blocks of DNA
found at the beginnings of the words of the rule. Every rule has a
unique genetic code which distinguishes it from all others.
Unlike in the US, invalid patents are not allowed. Further, giants
are prohibited: No future rule can have a genetic code longer than
25 characters.

167:14 - Kitt Bartlett
"The patented code of this rule" is a virus. All future rules must contain
at least one word from this rule's patent. Preserve the genome.

167:17 - Aron Wall
Future rules' codes must be made in two ways only:

Old Fashioned Way:
Your rule must have a VALID rule and an INVALID rule as parents. Put
the rules' genetic codes in either order, then remove every other letter
to be left with your starting code for your rule.

Cloning:
Pick one rule either VALID or INVALID for a parent, reproducing its
exact code.

Then put in any genetic material from words spliced in accordance with
previous rules. You now have your code for your rule. "Our overworked
Judge must be informed" which rules are the parent(s) or it is
invalidated for not having proper documentation.

*******************
Rules & Judgements
*******************

167:1 - VALID
Christopher Bartlett <bridgeweaver_at_mediaone.net>
 > As adenine, thymine, Cytosine and Guanine are the sole building blocks of
 > DNA, all rules must contain words that begin with the letters 'a', 't',
 > 'c', and 'g'.

Judgement: VALID
Style: A rather uninspired restriction, I'm afraid, but not overly
problematic as befits a rule early in the round. Call me a stickler, but in
real life anyway, Adenine, etc. are not the sole building blocks of DNA,
just the nucleotide bases. DNA also includes the deoxyribose sugars and the
phosphate groups. Including a first-timer bonus, I award +0.5.
*******

167:2 - INVALID
Karl wrote:
Begin 167.2
----
Goodness, can a word begin with more than one letter?
No matter, since this is FRC, we know that the DNA of a rule is actually
the individual words in it. Now which words qualify as adenine, thymine,
Cytosine and Guanine, I have no clue. Still, it's useful to remember that
every FRC rule will contain a cluster of at least five of the DNA, in the
same order, as the previous rule.
-----

Judgement:
Rule 1 says: adenine, thymine, Cytosine and Guanine are the sole building
blocks of
DNA
Rule 2 says: the DNA of a rule is actually the individual words in it
Is there a way to reconcile these? I wish the words "sole" and "actually"
were not there, but they are. What does it mean for something to "actually"
be something else - it could be that the DNA is only apparently made of A T
C and G, in fact, it is not, its made of the words of a rule. Imagine this:
Physicist #1: The sole building blocks of matter are subatomic particles
Physicist #2: Matter is actually the atoms composing it
Thus, one POSSIBLE interpretation of these two rules is that the DNA of a
rule is the words in it and those words, in turn, are composed at some
level of the four bases, A T C and G. Having found one possible and, I
deem, reasonable interpretation I will not judge this rule INVALID on this
count. I will stress that having found one interpretation does not rule out
a possibly infinite suite of other reasonable interpretations, all of which
are still in play until such time as a future rule narrows things down.
Players need not hew to the one interpretation I have outlined if they can
think of another. The Judge, of course, unless overruled by vote, is the
arbiter of reasonableness, but I will remind players also that an
alternative interpretation need not be _more_ reasonable than the one I
outlined, just not unreasonable.
I'm spelling this out for the benefit of the new players so that they
understand my philosophy of judging.
Having said all of this, I will nonetheless judge the rule INVALID for one
of the oldest and most tedious reasons in the FRC. This rule requires ALL
rules to contain something found in the previous rule. As there is no rule
previous to the first rule, the first rule is not in compliance with this
restriction. If the rule had specifically exempted the first rule or said
"from now on", or "in the future" or some other such thing it would have
been valid. So sorry.
Style: For making my head spin with the repercussions of the DNA for the
word Adenine is the word Adenine which is composed of, most likely,
Adenine... +1.0
*******

167:3 - VALID
David wrote:
The First One In
|It's useful to remember that| many Companies, universities, And
Governments have rushed into Biotechnology, before They've even explored
the potential risks and dangers. In accordance, we do not need Rule 167:1
to start creating rules.

Judgement: A truism. However, you'd better not ignore 167:1, because the
Judge does need to pay attention to it when judging your rules. Which I
have. No problems here.
Style: On theme, but where's the beef (GM, or otherwise), there's nothing
here to restrict other rules. Except for the fact that it is a capital R,
Rule, this is not a rule, it is a comment...
Including the new player bonus, I award +0.5
*******

167:4 - INVALID
Begin rule
------------------------------
The last word of each sentence in each new rule must be the
same as the first word in the sentence, except one letter may be
mutated, by removal or change; e. g. the becomes toe. ;-)
Lock up all hope of adding letters, for that is not true mutation, if
you look. On your honor, words must be real words, and repetition
is a no-no. But hyphenation is alright, so stop the with the tut, tut.
------------------------------
End rule
Jesse F. Weinstein; did I hear something, what?

Judgement: INVALID, In the second to last sentence, the mutation ON to
NO-NO (or NO) is not allowed by this rule (note that the rule restricts
"each new rule" and this is a new rule). The only mutations allowed are
removal of one letter or change of one letter where change is exemplified
by the transformation of THE to TOE.
Style: Good idea, unfortunate execution. With the new player bonus, +1.0
*******

167:5 - INVALID
167:4
 >>>
Rules from now on must contain a phrase of at least six words, indicated
with quotes, that must be used in the following Rule in order for it to be
valid; they will serve to pass on genetic information, something that can't
be done by mules.
 >>>
--David Glasser

Judgement: INVALID. Does not follow its own restriction.
Style: Is a mule an INVALID rule? An interesting concept to build on,
perhaps? Otherwise, not much excitement here. With the new player bonus, +1.0.
--
*******

167:6 - VALID
Begin rule
------------------------------
It is possible to patent Genetically modified life-forms. So, each time A
rule uses The "phrase of at least six words" from the previous rule, that
phrase is now patented, and the poster who created the rule is the only one
allowed to use it in subsequent rules.
If Rule 167:5. is declared invalid, then a poster Can place any one "phrase
of at least six words" in quotes, and it is patented and the poster is the
only one allowed to use it.
------------------------------
End rule

Judgement: VALID. Only sticky point is caused by: "any one phrase..." Here,
David has placed two phrases in quotes, not one. I'll allow that since they
are the same phrase, they can count as one phrase, not two.
Style: The patenting idea is on theme, but there is nothing genetically
modified about these phrases. The chance of someone accidentally using a
patented six word phrase is remote, so this is not much of a trap for
anyone. David has sacrificed elegance and courage for the safety of a
hedged bet on the validity of 167:5. It's true that this game is more about
getting valid rules than style, but I don't have to award positive style
for wishy-washiness... +0.1
*******

167:7 - VALID

Begin rule-----------
"all future rules must obey this" rule.I can't get away from rule #1.
End rule----------------
Jesse F. Weinstein

Judgement: VALID
Style: Good use of the patent laws to grab a useful phrase, but It will
have to be a long round before this bears tactical fruit. Besides this,
there's no restriction: +0.5.
*******

167:8 - VALID

Begin 167:8
-----------
The purpose of patents is to encourage future rules to build upon what is
already known. "If I can see further than others, it is because I have
stood on the shoulders of Giants" I believe it was said. Therefore, while
grabbing the whole of a patent is certainly wrong, it should be encouraged
to use part of a patent. To this end, it is required that all future rules
splice in exactly half of any patented phrase that appeared in the rule
previous.
Since trying to splice in half a word is just nonsensical, valid patents
will have an even number of words.
To show my dedication to this idea. I'll do it in this rule as well.
------------

Judgement: VALID. The phrasing of "valid patent" is problematic, if it
means that a patent with an odd number of words is not a patent and does
not receive patent protection under 167:6, then this rule is inconsistent
with 167:6. Thus, the "validity" of a patent is undefined at this time
(this is not inconsistent with the R.O.'s which only are concerned with the
validity of rules) and the handling of odd-worded patents with regard to
this rule is left as an exercise for the first one to be confronted with
the problem. Anyone who wants to attempt to close this loophole by defining
"valid patent" better is free to give it a shot...
Style: I would like to remind everyone that the round's theme is
Biotechnology, not Patent Law.
+0.75
*******

167:9 - INVALID

Begin rule
A word has the following properties:
1. It is preceded by at least one space.
2. It is followed by a space or one of the following punctuation
characters: .!?,;:"
3. It can be found in a dictionary.
"Only character strings that meet all these criteria" may be considered words.
end rule
Submitted by Kitt Bartlett

Judgement: INVALID. Inconsistent with 167:1, no word beginning with the
letter "G".
Style: VERY unstylish to fall prey to one's own rule, and considering how
few restrictions there are so far, that was a wee bit embarrassing, no?
Property #3 has loopholes big enough to drive a truck through - a
dictionary of Latvian slang, anyone? Even if it were airtight, was this
necessary? It has nothing to do with the theme and is boring to boot.
Consider yourself lucky with only -1.0.
*******

167:10 - INVALID

------------------------------
The last word of each sentence in each new rule must be the
same as the first word in the sentence, except one letter may be
mutated, by removal or change; e. g. the becomes toe. ;-)
Lock up all hope of adding letters, for that is not true
mutation, if you look. On your honor, words must be real words,
and repetition within a rule is a no. Bit of bio-piracy: "all rules must
include these words"; that's it.
------------------------------
Jesse Weinstein

Judgement: INVALID. Read my comment from last time carefully, Jesse... ON
-> NO is not allowed.
Style: Resubmission of a rule isn't so bad, resubmitting a rule that still
fails is pretty cheesy - it stinks like limburger. -2.0
*******

167:11 - INVALID

All future rules must contain a genetic modification of the patented phrase
from the previous rule. Valid genetic modifications are limited to the
following:
1. You may delete exactly one word.
2. You may add exactly one word.
3. You may substitute exactly one word for exactly one word in the sequence.
"Only character strings that meet any these criteria" are valid genetic
modifications.

Submitted by Kitt Bartlett
Judgement: Inconsistent with 167:8 which requires the "splicing in" of
exactly 1/2 of any patented phrase that appears in the rule previous. 167:8
is the most recent rule.
Style: +0.5
*******

167:12 - VALID

-- begin --
"The genetic code of a rule" is the sequence of building blocks of DNA
found at the beginnings of the words of the rule. Every rule has a
unique genetic code which distinguishes it from all others.
Unlike in the US, invalid patents are not allowed. Further, giants
are prohibited: No future rule can have a genetic code longer than
25 characters.
--- end ---
Submitted by Jesse Welton

Judgement: VALID. Does this rule "splice in exactly half of any patented
phrase that appeared in the rule previous"? The problem is the word
"exactly". The phrase in question has 18 words, 10 of which are found in
this rule. Two of them, "the" and "of" are found multiple times. I can find
a consistent interpretation in regarding nine of these to have been
"spliced" in, the rest were in this rule prior to the splicing events - we
just don't know at this point which words were spliced and which weren't.
Disallowing invalid patents resolves the problems that arose with 167:8,
now rules containing invalid patents will be found invalid.
Style: Builds naturally on 167:1 in a fascinating way that opens up all
kinds of possibilities. I like it. +2.5. (The genetic code of this
Judgement is: TATATTTTATTTTAATCAACTTTTTTATTATTCATATGCTT)
*******

167:13 - INVALID

geneticists cannot randomly modify genes and expect good results.
Therefore only "the patented portion of a rule" may be altered in a
subsequent rule.

Submitted by Kitt Bartlett

Judgement: INVALID. 167:3, for instance, is considerably altered from
167:1, which has no patented portion.

Style: nice idea, but fatally vague. +0.5.
*******

167:14 - VALID

"The patented code of this rule" is a virus. All future rules must contain
at least one word from this rule's patent. Preserve the genome.

Submitted by Kitt Bartlett

Judgement: VALID.

Style: Well, it's VALID, that counts for something, doesn't it? +0.1

*******

167:15 - INVALID
A building-block sequence is heteroserial if any blocks immediately adjacent
to it must be of a type different than any of those in the heteroserial
sequence. Examination of the genetic code of every prior rule and subsequent
"expensive laboratory experimentation by top men" has revealed GC, GCA, AG,
and CGA to all be heteroserial.

Submitted by Mark Nau

Judgement: INVALID. If I read this correctly, if "AG" is heteroserial this
means that, whenever the sequence "AG" appears in a DNA sequence (as a
sub-string), the building blocks immediately preceding and following it
cannot be either "A" or "G". Unfortunately, rule 167:1 contains the text
"and Guanidine are" which means that the genetic code for that rule
contains the substring "AGA". Thus, AG cannot be heteroserial for all valid
rules in this round. I cannot find any interpretation of this rule
consistent with this fact.

Style: Esoteric, but could have been interesting. Odd not to have analyzed
the genetic codes more thoroughly... +0.5.
*******

167:16 - INVALID

begin

Viral transmission from 167:14 can only occur inside "patented material for
this or any future rule".  Other use of these words goes against nature.

end

Submitted by Kitt Bartlett

Judgement:  INVALID.  The word "of" is part of 167:14's patented phrase,
and yet is used here outside of "patented material".

Style: Might have been an effective patch for 167:14's shortcomings, even
so, the restriction is ho-hum.  +0.2
*******

167:17 - VALID

 >>>>>>
Future rules' codes must be made in two ways only:

Old Fashioned Way:
Your rule must have a VALID rule and an INVALID rule as parents. Put
the rules' genetic codes in either order, then remove every other letter
to be left with your starting code for your rule.

Cloning:
Pick one rule either VALID or INVALID for a parent, reproducing its
exact code.

Then put in any genetic material from words spliced in accordance with
previous rules. You now have your code for your rule. "Our overworked
Judge must be informed" which rules are the parent(s) or it is
invalidated for not having proper documentation.
 >>>>>>>

Aron Wall

Jusgement: VALID. Note that "informing the Judge" must be done _within_
future rules. The Judge cannot make decisions on the validity of a rule
based on content (or lack thereof) not contained within the rule itself.
The extent to which a rule is in compliance with all restrictions must be
transparent (determinable, even if craftily hidden within a rule) to all
players. Thus, private messages to the Judge cannot be required for the
validity of a rule. To put this in the context of the R.O.'s: The Judge
must determine whether a _rule_ is consistent with all previous valid rules
and declare it INVALID if it is not (R.O. #6). Whether or not a _player_
has sent notification to the Judge before or after the fact in a separate
message publicly or privately, the _rule_ did not include the required
information and so would be judged INVALID.

Style: This restriction seems a bit tough for the first week of the round,
and not applying it to this rule as an example of how it can be done was a
bit wimpy. On the other hand, the concept here is exemplary - Aron has at a
stroke brought the round closer to the theme, given purpose to the genetic
codes and created a great splicing mechanism that corrects the unintended
weaknesses in 167:8. +2.0
*******

167:18

Parent 167:14
"Our overworked Judge will" make us obey rules.  This can't be
taken for nothing.  It is a parasitic rule: A rule-writer must carefully
pick the words in their rule, ignoring patented parts, since he must
put in the genetic infomation of my rule, in the same order, in his

Submitted by Jesse F. W.

Judgement: INVALID.  This rule is attempting to clone 167:14.  In cloning
the genetic code of the clone is the same as that as the parent with the
exception of any genetic material from words _spliced in accordance with
previous rules_.  The only rule supporting splicing is 167:8, which
requires the splicing in of 1/2 of the patented phrase from the previous
rule.  The patented phrase from the previous rule in this case has no
genetic material. Therefore, either the genetic code of this rule is
identical to that of 167:14 (which is inconsistent with 167:12) or it is
not identical (which is inconsistent with 167:14).  QED.

Style: The phrasing and grammar of this rule are awkward and its meaning is
unclear.  The effect of this rule if it were valid would be difficult in
the extreme and probably round-killing.  I would not suggest resubmitting a
corrected version.  -2.0
*******

167:19

 >>>>>>
Parents: 167:14, 167:18.
  Cloning, as it is now, causes outrage for some people. So that "spreading
genetic research won't incite zealous conservative protests", at no point may
cloned rules outnumber those produced by other methods of genetic
reproduction.
 >>>>>>

Submitted by Factitious

Judgement: INVALID.  Inconsistent with 167:8, does not include 1/2 of the
patented phrase found in the previous [VALID] rule, 167:17.

Style: Topical, restriction appropriate to the ideas expressed, utilized
the genetic recombination rule properly.  I would encourage a resubmit, but
Factitious is now out of time, so sorry... +1.5

--
Rule Date: 2001-08-27 20:36:56 GMT


This archive was generated by hypermail 2.1.5 : Fri Oct 10 2008 - 15:00:01 PDT