From: Jeremy D. Selengut (selengut_at_nih.gov)
Date: Wed Aug 22 2001 - 11:19:13 PDT
Theme: Biotechnology Eligibility: Jesse Welton Aug 28, 21:38:17 +2.5 Current Style Leader Karl Low Aug 28, 18:20:23 +1.75 David Lerner Aug 28, 15:26:50 +0.6 Jesse F. W. Aug 27, 17:30:39 -0.5 > All others < Aug 27, 14:18:55 David Glasser Aug 26, 14:18:55 +0.5 Kitt Bartlett Aug 24, 14:18:55 +0.5 Rule summary: 167:1 Kitt Bartlett Aug 20, 14:18:55 VALID +0.5 Words begin w/ACTG 167:2 Karl Low Aug 20, 16:13:00 INVALID +1.0 Inconsistent w/167:1 167:3 David Lerner Aug 20, 16:39:36 VALID +0.5 No restriction 167:4 Jesse F. W. Aug 20, 16:55:17 INVALID +1.0 Inconsistent w/self 167:5 David Glasser Aug 21, 03:07:23 INVALID +0.5 Inconsistent w/self 167:6 David Lerner Aug 21, 15:26:50 VALID +0.1 Establishes patents 167:7 Jesse F. W. Aug 21, 17:30:39 VALID +0.5 No restriction 167:8 Karl Low Aug 21, 18:20:23 VALID +0.75 Reuse of 1/2 patents 167:9 Kitt Bartlett Aug 21, 18:47:30 INVALID -1.0 Inconsistent w/167:1 167:10 Jesse F. W. Aug 21, 18:50:11 INVALID -2.0 Inconsistent w/self 167:11 Kitt Bartlett Aug 21, 18:55:02 INVALID +0.5 Inconsistent w/167:8 167:12 Jesse Welton Aug 21, 21:38:17 VALID +2.5 Genetic Code, No odd patents 167:13 Kitt Bartlett Aug 22, 16:12:42 INVALID +0.5 Inconsistent w/167:3... Rules & Judgements: ******* 167:1 - VALID Christopher Bartlett <bridgeweaver_at_mediaone.net> > As adenine, thymine, Cytosine and Guanine are the sole building blocks of > DNA, all rules must contain words that begin with the letters 'a', 't', > 'c', and 'g'. Judgement: VALID Style: A rather uninspired restriction, I'm afraid, but not overly problematic as befits a rule early in the round. Call me a stickler, but in real life anyway, Adenine, etc. are not the sole building blocks of DNA, just the nucleotide bases. DNA also includes the deoxyribose sugars and the phosphate groups. Including a first-timer bonus, I award +0.5. ******* 167:2 - INVALID Karl wrote: Begin 167.2 ---- Goodness, can a word begin with more than one letter? No matter, since this is FRC, we know that the DNA of a rule is actually the individual words in it. Now which words qualify as adenine, thymine, Cytosine and Guanine, I have no clue. Still, it's useful to remember that every FRC rule will contain a cluster of at least five of the DNA, in the same order, as the previous rule. ----- Judgement: Rule 1 says: adenine, thymine, Cytosine and Guanine are the sole building blocks of DNA Rule 2 says: the DNA of a rule is actually the individual words in it Is there a way to reconcile these? I wish the words "sole" and "actually" were not there, but they are. What does it mean for something to "actually" be something else - it could be that the DNA is only apparently made of A T C and G, in fact, it is not, its made of the words of a rule. Imagine this: Physicist #1: The sole building blocks of matter are subatomic particles Physicist #2: Matter is actually the atoms composing it Thus, one POSSIBLE interpretation of these two rules is that the DNA of a rule is the words in it and those words, in turn, are composed at some level of the four bases, A T C and G. Having found one possible and, I deem, reasonable interpretation I will not judge this rule INVALID on this count. I will stress that having found one interpretation does not rule out a possibly infinite suite of other reasonable interpretations, all of which are still in play until such time as a future rule narrows things down. Players need not hew to the one interpretation I have outlined if they can think of another. The Judge, of course, unless overruled by vote, is the arbiter of reasonableness, but I will remind players also that an alternative interpretation need not be _more_ reasonable than the one I outlined, just not unreasonable. I'm spelling this out for the benefit of the new players so that they understand my philosophy of judging. Having said all of this, I will nonetheless judge the rule INVALID for one of the oldest and most tedious reasons in the FRC. This rule requires ALL rules to contain something found in the previous rule. As there is no rule previous to the first rule, the first rule is not in compliance with this restriction. If the rule had specifically exempted the first rule or said "from now on", or "in the future" or some other such thing it would have been valid. So sorry. Style: For making my head spin with the repercussions of the DNA for the word Adenine is the word Adenine which is composed of, most likely, Adenine... +1.0 ******* 167:3 - VALID David wrote: The First One In |It's useful to remember that| many Companies, universities, And Governments have rushed into Biotechnology, before They've even explored the potential risks and dangers. In accordance, we do not need Rule 167:1 to start creating rules. Judgement: A truism. However, you'd better not ignore 167:1, because the Judge does need to pay attention to it when judging your rules. Which I have. No problems here. Style: On theme, but where's the beef (GM, or otherwise), there's nothing here to restrict other rules. Except for the fact that it is a capital R, Rule, this is not a rule, it is a comment... Including the new player bonus, I award +0.5 ******* 167:4 - INVALID Begin rule ------------------------------ The last word of each sentence in each new rule must be the same as the first word in the sentence, except one letter may be mutated, by removal or change; e. g. the becomes toe. ;-) Lock up all hope of adding letters, for that is not true mutation, if you look. On your honor, words must be real words, and repetition is a no-no. But hyphenation is alright, so stop the with the tut, tut. ------------------------------ End rule Jesse F. Weinstein; did I hear something, what? Judgement: INVALID, In the second to last sentence, the mutation ON to NO-NO (or NO) is not allowed by this rule (note that the rule restricts "each new rule" and this is a new rule). The only mutations allowed are removal of one letter or change of one letter where change is exemplified by the transformation of THE to TOE. Style: Good idea, unfortunate execution. With the new player bonus, +1.0 ******* 167:5 - INVALID 167:4 >>> Rules from now on must contain a phrase of at least six words, indicated with quotes, that must be used in the following Rule in order for it to be valid; they will serve to pass on genetic information, something that can't be done by mules. >>> --David Glasser Judgement: INVALID. Does not follow its own restriction. Style: Is a mule an INVALID rule? An interesting concept to build on, perhaps? Otherwise, not much excitement here. With the new player bonus, +1.0. -- ******* 167:6 - VALID Begin rule ------------------------------ It is possible to patent Genetically modified life-forms. So, each time A rule uses The "phrase of at least six words" from the previous rule, that phrase is now patented, and the poster who created the rule is the only one allowed to use it in subsequent rules. If Rule 167:5. is declared invalid, then a poster Can place any one "phrase of at least six words" in quotes, and it is patented and the poster is the only one allowed to use it. ------------------------------ End rule Judgement: VALID. Only sticky point is caused by: "any one phrase..." Here, David has placed two phrases in quotes, not one. I'll allow that since they are the same phrase, they can count as one phrase, not two. Style: The patenting idea is on theme, but there is nothing genetically modified about these phrases. The chance of someone accidentally using a patented six word phrase is remote, so this is not much of a trap for anyone. David has sacrificed elegance and courage for the safety of a hedged bet on the validity of 167:5. It's true that this game is more about getting valid rules than style, but I don't have to award positive style for wishy-washiness... +0.1 ******* 167:7 - VALID Begin rule----------- "all future rules must obey this" rule.I can't get away from rule #1. End rule---------------- Jesse F. Weinstein Judgement: VALID Style: Good use of the patent laws to grab a useful phrase, but It will have to be a long round before this bears tactical fruit. Besides this, there's no restriction: +0.5. ******* 167:8 - VALID Begin 167:8 ----------- The purpose of patents is to encourage future rules to build upon what is already known. "If I can see further than others, it is because I have stood on the shoulders of Giants" I believe it was said. Therefore, while grabbing the whole of a patent is certainly wrong, it should be encouraged to use part of a patent. To this end, it is required that all future rules splice in exactly half of any patented phrase that appeared in the rule previous. Since trying to splice in half a word is just nonsensical, valid patents will have an even number of words. To show my dedication to this idea. I'll do it in this rule as well. ------------ Judgement: VALID. The phrasing of "valid patent" is problematic, if it means that a patent with an odd number of words is not a patent and does not receive patent protection under 167:6, then this rule is inconsistent with 167:6. Thus, the "validity" of a patent is undefined at this time (this is not inconsistent with the R.O.'s which only are concerned with the validity of rules) and the handling of odd-worded patents with regard to this rule is left as an exercise for the first one to be confronted with the problem. Anyone who wants to attempt to close this loophole by defining "valid patent" better is free to give it a shot... Style: I would like to remind everyone that the round's theme is Biotechnology, not Patent Law. +0.75 ******* 167:9 - INVALID Begin rule A word has the following properties: 1. It is preceded by at least one space. 2. It is followed by a space or one of the following punctuation characters: .!?,;:" 3. It can be found in a dictionary. "Only character strings that meet all these criteria" may be considered words. end rule Submitted by Kitt Bartlett Judgement: INVALID. Inconsistent with 167:1, no word beginning with the letter "G". Style: VERY unstylish to fall prey to one's own rule, and considering how few restrictions there are so far, that was a wee bit embarrassing, no? Property #3 has loopholes big enough to drive a truck through - a dictionary of Latvian slang, anyone? Even if it were airtight, was this necessary? It has nothing to do with the theme and is boring to boot. Consider yourself lucky with only -1.0. ******* 167:10 - INVALID ------------------------------ The last word of each sentence in each new rule must be the same as the first word in the sentence, except one letter may be mutated, by removal or change; e. g. the becomes toe. ;-) Lock up all hope of adding letters, for that is not true mutation, if you look. On your honor, words must be real words, and repetition within a rule is a no. Bit of bio-piracy: "all rules must include these words"; that's it. ------------------------------ Jesse Weinstein Judgement: INVALID. Read my comment from last time carefully, Jesse... ON -> NO is not allowed. Style: Resubmission of a rule isn't so bad, resubmitting a rule that still fails is pretty cheesy - it stinks like limburger. -2.0 ******* 167:11 - INVALID All future rules must contain a genetic modification of the patented phrase from the previous rule. Valid genetic modifications are limited to the following: 1. You may delete exactly one word. 2. You may add exactly one word. 3. You may substitute exactly one word for exactly one word in the sequence. "Only character strings that meet any these criteria" are valid genetic modifications. Submitted by Kitt Bartlett Judgement: Inconsistent with 167:8 which requires the "splicing in" of exactly 1/2 of any patented phrase that appears in the rule previous. 167:8 is the most recent rule. Style: +0.5 ******* 167:12 - VALID -- begin -- "The genetic code of a rule" is the sequence of building blocks of DNA found at the beginnings of the words of the rule. Every rule has a unique genetic code which distinguishes it from all others. Unlike in the US, invalid patents are not allowed. Further, giants are prohibited: No future rule can have a genetic code longer than 25 characters. --- end --- Submitted by Jesse Welton Judgement: VALID. Does this rule "splice in exactly half of any patented phrase that appeared in the rule previous"? The problem is the word "exactly". The phrase in question has 18 words, 10 of which are found in this rule. Two of them, "the" and "of" are found multiple times. I can find a consistent interpretation in regarding nine of these to have been "spliced" in, the rest were in this rule prior to the splicing events - we just don't know at this point which words were spliced and which weren't. Disallowing invalid patents resolves the problems that arose with 167:8, now rules containing invalid patents will be found invalid. Style: Builds naturally on 167:1 in a fascinating way that opens up all kinds of possibilities. I like it. +2.5. (The genetic code of this Judgement is: TATATTTTATTTTAATCAACTTTTTTATTATTCATATGCTT) ******* -- Rule Date: 2001-08-22 18:20:30 GMT
This archive was generated by hypermail 2.1.5 : Thu Nov 24 2011 - 10:48 PST