167:12, VALID, +2.5

From: Jeremy D. Selengut (selengut_at_nih.gov)
Date: Wed Aug 22 2001 - 08:15:51 PDT


>-- begin --
>"The genetic code of a rule" is the sequence of building blocks of DNA
>found at the beginnings of the words of the rule.  Every rule has a
>unique genetic code which distinguishes it from all others.
>
>Unlike in the US, invalid patents are not allowed.  Further, giants
>are prohibited: No future rule can have a genetic code longer than
>25 characters.
>--- end ---

Submitted by Jesse Welton

Judgement:  VALID.  Does this rule "splice in exactly half of any patented
phrase that appeared in the rule previous"?  The problem is the word
"exactly".  The phrase in question has 18 words, 10 of which are found in
this rule.  Two of them, "the" and "of" are found multiple times.  I can
find a consistent interpretation in regarding nine of these to have been
"spliced" in, the rest were in this rule prior to the splicing events - we
just don't know at this point which words were spliced and which
weren't.  Disallowing invalid patents resolves the problems that arose with
167:8, now rules containing invalid patents will be found invalid.

Style: Builds naturally on 167:1 in a fascinating way that opens up all
kinds of possibilities.  I like it.  +2.5.  (The genetic code of this
Judgement is: TATATTTTATTTTAATCAACTTTTTTATTATTCATATGCTT)

--
Rule Date: 2001-08-22 15:16:46 GMT


This archive was generated by hypermail 2.1.5 : Fri Oct 10 2008 - 15:00:01 PDT